Help

  1. Tutorial

    To start a tutorial, please do the following:
    1. Go to HOME menu and click "Start a Tutorial Session" button.
    2. In each page, find the dropdown box entitled "Tutotrial session" and follow the instructions therein.
      • Dashboard for tutorial
      • Analysis for tutorial
    3. The test data set used in the tutorial session is from an RNA structural mapping study using the mutate-and-map strategy (Kladwang and Das, 2010; Kladwang et al., 2011).
      • Sequence: GGAAAGCUGACAGGAUAUGGGCAUGACAAAAGUCAUGCGCUGGCUACAAAAGUAGGCAGCCUAGAUCAAAAGAUCUAGCCAGAAGGGUCAGCAAAGAAACAACAACAACAAC
      • Sequence length: 112
      • Offset and probing region length: 0 and 92, respectively
      • Structure: .....((((((......((((((((((....)))))))((((.((((....)))).))))(((((((....)))))))))).....))))))....................
      • Chemical modifications used: SHAPE, DMS, ddTTP, no_mod (no modification)
      • Number of capillaries: 6
      • Number of bands per capillary: 92
      • Signal and reference channels: 1 and 4, respectively

    4. Do you need more test data?
      1. Test data 1 [click to download]
        • Sequence: GGCAGGACGAUGUUGCUAUGAAUGUAUAGUACGACAGGAUAUUUGUUAUUAAAGAAGGGUCGCCGCGUACACCUAUGCGGACAUCGUUAAAGAAACAACAACAACAAC
        • Sequence length: 108
        • Offset and probing region length: 0 and 88
        • Structure: .....(((((((((((((((....)))))))((((......((((....)))).....))))(((((((....)))))))))))))))....................
        • Chemical modifications (forward order): DMS, DMS, DMS, no_mod, and ddTTP
        • Number of bands per capillary: 88
        • Signal and reference channels: 1 and 4
      2. Test data 2 [click to download]
        • Sequence: GGCGCGUUUGAAGGAUAUCGGCCAGCGGCAUCGUUGGUAACAUGUAGUCGGCUAUUUGUUAACUGUUCUAUAACGGUUCGAGAAGGUCAAACAAAGAAACAACAACAACAAC
        • Sequence length: 112
        • Offset and probing region length: 0 and 92
        • Structure: .....((((((......((((((((((....)))))))((((.((((....)))).))))(((((((....)))))))))).....))))))....................
        • Chemical modifications (forward order): SHAPE, SHAPE, DMS, DMS, no_mod, and ddTTP
        • Number of bands per capillary: 92
        • Signal and reference channels: 1 and 4
      3. Test data 3 [click to download]
        • Sequence: GGAAAGUAGAGGAUAUGCAGUUCAGUCAAAAGACAGAGAAAACUCAGAACAGUACACAGAAAACUGAGUGAAAACACAGUACAGCAGAAGGCUACAAAGAAACAACAACAACAAC
        • Sequence length: 115
        • Offset and probing region length: 0 and 95
        • Structure: .....((((......(((.((((.(((....))).(((....))).)))).((((.(((....))).(((....))).)))).))).....))))....................
        • Chemical modifications (forward order): SHAPE, SHAPE, DMS, DMS, no_mod, and ddTTP
        • Number of bands per capillary: 95
        • Signal and reference channels: 1 and 4

  2. HiTRACE Menu

    • HOME: this is the main page of the HiTRACE website. You can create a new session or start a tutorial session here. HiTRACE is free and open to all users, and there is no login requirement.
    • DASHBOARD: this shows the status of your session and its jobs. Note that a job is the basic unit of HiTRACE analysis and that you can launch multiple jobs in a session.
    • ANALYSIS: this lets you follow the analysis pipeline of HiTRACE. It consists of multiple steps - channel selection, region of interest (ROI) specification, intermediate checkpoint, experimental information, band annotation, and final result. See below for more details of each step.
    • HELP: this page.
    • ABOUT: this page contains an introduction to HiTRACE and contact information of the developers.

  3. Details of HiTRACE analysis steps

    Step 1 (Channel Selection)

    In order to start CE analysis, you have to select the signal and reference channels. By default, the first and the last channels represent the signal and reference, respectively. Depending on the experimental procedure you use, any arbitrary channels can be the signal and reference. In this step, examine the CE profiles shown below and select one signal and one reference channel.

    Step 2 (ROI Specification)

    In this step, you are to specify the region of interest (ROI) on your CE profile. HiTRACE will use only the specified ROI in downstream analysis. To facilitate your choice, the signal and reference channel profiles are shown below. Left click, drag, and release, in order to specify the start and end of your ROI. Alternatively, you can let HiTRACE detect your ROI automatically. To do that, simply click the Auto Specification button. In any case, the start and end points of your ROI will be presented in pixel units. Additionally, you can zoom in and out vertically, in order to magnify or reduce the images of CE profiles.

    Step 3 (Intermediate Checkpoint)

    In this step, you can check the intermediate result HiTRACE has processed so far. If you are satisfied with it, you can proceed to the next step for experimental information. Otherwise, you can go back to the previous steps and redo your analysis.

    Step 4 (Experiment Information)

    In this step, you setup the experimental information, which are the sequence, the desired structure, the probing region and the type of each capillary. Setting up a experimental information in two phases.

    • In this Step 4a, you are required to enter the nucleotide sequence under study. Please note that you can use use only five symbols (A, C, G, T, U) in specifying the sequence. After specifying the sequence, you can optionally set the offset (the index of starting residue - 1) and the index of the first reverse-transcribed nucleotide (FRTN). That is, the probing region will be from the nucleotide at (offset + 1) to FRTN. Additionally, you can give the desired structure by entering its dot-and-bracket notation (DBN). In case you are not aware of or do not want to specify the desired structure, the default notation (a series of dots) will be used.



    • In this Step 4b, you should specify the type of each capillary. Currently, 8 different chemical probing types are supported: SHAPE, DMS, CMCT, no modification, ddTTP, ddCTP, ddATP, and ddGTP. On the CE image, you click one capillary at a time to specify its type. In order to select multiple capillaries at a time and set their common type, you can left-click on a capillary and then drag until the final capillary. To deselect a capillary, click it again.

    Step 5 (Band Annotation)

    In this step, you can annotate each band locations with a residue. On the image, you can add or remove annotations by clicking a position. You can adjust the brightness and size of the image for fine tuning. HiTRACE-Web also provides a way to perform band annotation in an automated fashion. To use this feature, simply click the "Automated Band Annotation" button.


    In addition to the automated band annotation functionality, users are provided with a user-friendly interface to fine-tune band annotation results manually. Red circles represent the residue locations. Each type of nucleotide is associated with a different color (G: green, C: cyan, U: blue, and A: red). By clicking the image, user can (de)select the position of individual residues. The auto-assigned bands are shown on the right side in gray for easier referencing when manually adjusting the assignment.

    Step 6 (Final Result)

    Now you are done! HiTRACE-Web provides the images of the aligned signal and reference channels. You can also download the peak quantification result. In case you want to redo analysis, you can go back to previous steps.

Copyright 2012 Das lab, Stanford University &
Yoon lab, Seoul National University
All Rights Reserved.